Anlage 1 PatV, Standards für die Einreichung von Sequenzprotokollen

Anlage 1 PatV
Verordnung zum Verfahren in Patentsachen vor dem Deutschen Patent- und Markenamt (Patentverordnung - PatV)
Bundesrecht

Anhangteil

Titel: Verordnung zum Verfahren in Patentsachen vor dem Deutschen Patent- und Markenamt (Patentverordnung - PatV)
Normgeber: Bund
Amtliche Abkürzung: PatV
Gliederungs-Nr.: 420-1-13
Normtyp: Rechtsverordnung

Anlage 1
(zu § 11 Abs. 1 Satz 2)

Definitionen
  1. 1.

    Im Rahmen dieses Standards gelten folgende Definitionen:

    1. i)

      Unter einem "Sequenzprotokoll" ist ein Teil der Beschreibung der Anmeldung in der eingereichten Fassung oder ein zur Anmeldung nachgereichtes Schriftstück zu verstehen, das die Nucleotid- und/oder Aminosäuresequenzen im Einzelnen offenbart und sonstige verfügbare Angaben enthält.

    2. ii)

      In das Protokoll dürfen nur unverzweigte Sequenzen von mindestens 4 Aminosäuren bzw. unverzweigte Sequenzen von mindestens 10 Nucleotiden aufgenommen werden. Verzweigte Sequenzen, Sequenzen mit weniger als 4 genau definierten Nucleotiden oder Aminosäuren sowie Sequenzen mit Nucleotiden oder Aminosäuren, die nicht in Nr. 48, Tabellen 1, 2, 3 und 4 aufgeführt sind, sind ausdrücklich ausgenommen.

    3. iii)

      Unter "Nucleotiden" sind nur Nucleotide zu verstehen, die mittels der in Nr. 48, Tabelle 1 aufgeführten Symbole wiedergegeben werden können. Modifikationen wie z.B. methylierte Basen können nach der Anleitung in Nr. 48, Tabelle 2 beschrieben werden, sind aber in der Nucleotidsequenz nicht explizit auszuweisen.

    4. iv)

      Unter "Aminosäuren" sind die in Nr. 48, Tabelle 3 aufgeführten gängigen L-Aminosäuren aus den natürlich vorkommenden Proteinen zu verstehen. Aminosäuresequenzen, die mindestens eine D-Aminosäure enthalten, fallen nicht unter diese Definition. Aminosäuresequenzen, die posttranslational modifizierte Aminosäuren enthalten, können mittels der in Nr. 48, Tabelle 3 aufgeführten Symbole wie die ursprünglich translatierte Aminosäure beschrieben werden, wobei die modifizierten Positionen wie z.B. Hydroxylierungen oder Glykosylierungen nach der Anleitung in Nr. 48, Tabelle 4 beschrieben werden, diese Modifikationen aber in der Aminosäuresequenz nicht explizit auszuweisen sind. Unter die vorstehende Definition fallen auch Peptide oder Proteine, die anhand der in Nr. 48, Tabelle 3 aufgeführten Symbole sowie einer an anderer Stelle aufgenommenen Beschreibung, die beispielsweise Aufschluss über ungewöhnliche Bindungen, Quervernetzungen (z.B. Disulfidbrücken) und "end caps", Nichtpeptidbindungen usw. gibt, als Sequenz wiedergegeben werden können.

    5. v)

      Unter "Sequenzkennzahl" ist eine Zahl zu verstehen, die jeder im Protokoll aufgeführten Sequenz als SEQ ID NO zugewiesen wird.

    6. vi)

      Die "numerische Kennzahl" ist eine dreistellige Zahl, die für ein bestimmtes Datenelement steht.

    7. vii)

      Unter "sprachneutralem Vokabular" ist ein festes Vokabular zu verstehen, das im Sequenzprotokoll zur Wiedergabe der vom Hersteller einer Sequenzdatenbank vorgeschriebenen wissenschaftlichen Begriffe verwendet wird (dazu gehören wissenschaftliche Namen, nähere Bestimmungen und ihre Entsprechungen im festen Vokabular, die Symbole in Nr. 48, Tabellen 1, 2, 3 und 4 und die Merkmalschlüssel in Nr. 48, Tabellen 5 und 6).

    8. viii)

      Unter "zuständiger Behörde" ist die Internationale Recherchenbehörde oder die mit der internationalen vorläufigen Prüfung beauftragte Behörde, die die internationale Recherche bzw. die internationale vorläufige Prüfung zu der internationalen Anmeldung durchführt, oder das Bestimmungsamt bzw. ausgewählte Amt zu verstehen, das mit der Bearbeitung der internationalen Anmeldung begonnen hat.

Sequenzprotokoll
  1. 2.

    Das Sequenzprotokoll im Sinne der Nr. 1 i) ist ans Ende der Anmeldung zu setzen, wenn es mit ihr zusammen eingereicht wird. Dieser Teil ist mit "Sequenzprotokoll" oder "Sequence Listing" zu überschreiben, muss mit einer neuen Seite beginnen und sollte gesondert nummeriert werden. Das Sequenzprotokoll ist Bestandteil der Beschreibung; vorbehaltlich Nr. 35 erübrigt es sich deshalb, die Sequenzen in der Beschreibung an anderer Stelle nochmals zu beschreiben.

  2. 3.

    Wird das Sequenzprotokoll im Sinne der Nr. 1 i) nicht zusammen mit der Anmeldung eingereicht, sondern als gesondertes Schriftstück nachgereicht (siehe Nr. 36), so ist es mit der Überschrift "Sequenzprotokoll" oder "Sequence Listing" und einer gesonderten Seitennummerierung zu versehen. Die in der Anmeldung in der eingereichten Fassung gewählte Nummerierung der Sequenzen (siehe Nr. 4) ist auch im nachgereichten Sequenzprotokoll beizubehalten.

  3. 4.

    Jeder Sequenz wird eine eigene Sequenzkennzahl zugeteilt. Die Kennzahlen beginnen mit 1 und setzen sich in aufsteigender Reihenfolge als ganze Zahlen fort. Gibt es zu einer Kennzahl keine Sequenz, so ist am Anfang der auf die SEQ ID NO folgenden Zeile unter der numerischen Kennzahl <400> der Code 000 anzugeben. Unter der numerischen Kennzahl <160> ist die Gesamtzahl der SEQ ID NOs anzugeben, und zwar unabhängig davon, ob im Anschluss an eine SEQ ID NO eine Sequenzkennzahl oder der Code 000 folgt.

  4. 5.

    In der Beschreibung, in den Ansprüchen und in den Zeichnungen der Anmeldung ist auf die im Sequenzprotokoll dargestellten Sequenzen mit "SEQ ID NO", gefolgt von der betreffenden Kennzahl, zu verweisen.

  5. 6.

    Für die Darstellung von Nucleotid- und Aminosäuresequenzen ist zumindest eine der folgenden drei Möglichkeiten zu wählen:

    1. i)

      nur Nucleotidsequenz,

    2. ii)

      nur Aminosäuresequenz,

    3. iii)

      Nucleotidsequenz zusammen mit der entsprechenden Aminosäuresequenz.

    Bei einer Offenbarung im unter Ziffer iii) genannten Format muss die Aminosäuresequenz als solche im Sequenzprotokoll mit einer eigenen Sequenzkennzahl gesondert offenbart werden.

Nucleotidsequenzen
Zu verwendende Symbole
  1. 7.

    Nucleotidsequenzen sind nur anhand eines Einzelstrangs in Richtung vom 5'-Ende zum 3'-Ende von links nach rechts wiederzugeben. Die Begriffe 3' und 5' werden in der Sequenz nicht dargestellt.

  2. 8.

    Die Basen einer Nucleotidsequenz sind anhand der einbuchstabigen Codes für Nucleotidsequenzzeichen darzustellen. Es dürfen nur die in Nr. 48, Tabelle 1 aufgeführten Kleinbuchstaben verwendet werden.

  3. 9.

    Modifizierte Basen sind in der Sequenz selbst wie die entsprechenden unmodifizierten Basen oder mit "n" wiederzugeben, wenn die modifizierte Base zu den in Nr. 48, Tabelle 2 aufgeführten gehört; die Modifikation ist im Merkmalsteil des Sequenzprotokolls anhand der Codes in Nr. 48, Tabelle 2 näher zu beschreiben. Diese Codes dürfen in der Beschreibung oder im Merkmalsteil des Sequenzprotokolls, nicht jedoch in der Sequenz selbst verwendet werden (siehe auch Nr. 31). Das Symbol "n" steht immer nur für ein einziges unbekanntes oder modifiziertes Nucleotid.

Zu verwendendes Format
  1. 10.

    Bei Nucleotidsequenzen sind höchstens 60 Basen pro Zeile - mit einem Leerraum zwischen jeder Gruppe von 10 Basen - aufzuführen.

  2. 11.

    Die Basen einer Nucleotidsequenz (einschließlich Intronen) sind jeweils in Zehnergruppen aufzuführen; dies gilt nicht für die codierenden Teile der Sequenz. Bleiben am Ende nichtcodierender Teile einer Sequenz weniger als 10 Basen übrig, so sind sie zu einer Gruppe zusammenzufassen und durch einen Leerraum von angrenzenden Gruppen zu trennen.

  3. 12.

    Die Basen der codierenden Teile einer Nucleotidsequenz sind als Tripletts (Codonen) aufzuführen.

  4. 13.

    Die Zählung der Nucleotidbasen beginnt bei der ersten Base der Sequenz mit 1. Von hier aus ist die gesamte Sequenz in 5'-3'-Richtung fortlaufend durchzuzählen. Am rechten Rand ist jeweils neben der Zeile mit den einbuchstabigen Codes für die Basen die Nummer der letzten Base dieser Zeile anzugeben. Die vorstehend beschriebene Zählweise für Nucleotidsequenzen gilt auch für Nucleotidsequenzen mit ringförmiger Konfiguration, wobei allerdings die Bestimmung des ersten Nucleotids der Sequenz dem Anmelder überlassen bleibt.

  5. 14.

    Eine Nucleotidsequenz, die aus einem oder mehreren nichtbenachbarten Abschnitten einer größeren Sequenz oder aus Abschnitten verschiedener Sequenzen besteht, ist als gesonderte Sequenz mit eigener Sequenzkennzahl zu nummerieren. Sequenzen mit einer oder mehreren Lücken sind als mehrere gesonderte Sequenzen mit eigenen Sequenzkennzahlen zu nummerieren, wobei die Zahl der gesonderten Sequenzen der Zahl der jeweils zusammenhängenden Sequenzdatenreihen entspricht.

Aminosäuresequenzen
Zu verwendende Symbole
  1. 15.

    Die Aminosäuren einer Protein- oder Peptidsequenz sind in Richtung von der Amino- zur Carboxylgruppe von links nach rechts aufzuführen, wobei die Amino- und Carboxylgruppen in der Sequenz nicht darzustellen sind.

  2. 16.

    Die Aminosäuren sind anhand des dreibuchstabigen Codes mit großem Anfangsbuchstaben entsprechend der Liste in Nr. 48, Tabelle 3 darzustellen. Eine Aminosäuresequenz, die einen Leerraum oder interne Terminatorsymbole (z.B. "Ter", " * " oder " . ") enthält, ist nicht als eine einzige Aminosäuresequenz, sondern als getrennte Aminosäuresequenzen darzustellen (siehe Nr. 21).

  3. 17.

    Modifizierte und seltene Aminosäuren sind in der Sequenz selbst wie die entsprechenden unmodifizierten Aminosäuren oder mit "Xaa" wiederzugeben, wenn sie zu den in Nr. 48, Tabelle 4 aufgeführten gehören und die Modifikation im Merkmalsteil des Sequenzprotokolls anhand der Codes in Nr. 48, Tabelle 4 näher beschrieben wird. Diese Codes dürfen in der Beschreibung oder im Merkmalsteil des Sequenzprotokolls, nicht jedoch in der Sequenz selbst verwendet werden (siehe auch Nr. 31). Das Symbol "Xaa" steht immer nur für eine einzige unbekannte oder modifizierte Aminosäure.

Zu verwendendes Format
  1. 18.

    Bei Protein- oder Peptidsequenzen sind höchstens 16 Aminosäuren pro Zeile mit einem Leerraum zwischen den einzelnen Aminosäuren aufzuführen.

  2. 19.

    Die den Codonen der codierenden Teile einer Nucleotidsequenz entsprechenden Aminosäuren sind unmittelbar unter den jeweiligen Codonen anzugeben. Wird ein Codon durch ein Intron aufgespalten, so ist das Aminosäuresymbol unter dem Teil des Codons anzugeben, der zwei Nucleotide enthält.

  3. 20.

    Die Zählung der Aminosäuren beginnt bei der ersten Aminosäure der Sequenz mit 1. Fakultativ können die dem reifen Protein vorausgehenden Aminosäuren wie beispielsweise Präsequenzen, Prosequenzen, Präprosequenzen und Signalsequenzen, soweit vorhanden, mit negativem Vorzeichen nummeriert werden, wobei die Rückwärtszählung mit der Aminosäure vor Nummer 1 beginnt. Null (0) wird nicht verwendet, wenn Aminosäuren zur Abgrenzung gegen das reife Protein mit negativem Vorzeichen nummeriert werden. Die Nummern sind im Abstand von jeweils 5 Aminosäuren unter der Sequenz anzugeben. Die vorstehend beschriebene Zählweise für Aminosäuresequenzen gilt auch für Aminosäuresequenzen mit ringförmiger Konfiguration, wobei allerdings die Bestimmung der ersten Aminosäure der Sequenz dem Anmelder überlassen bleibt.

  4. 21.

    Eine Aminosäuresequenz, die aus einem oder mehreren nichtbenachbarten Abschnitten einer größeren Sequenz oder aus Abschnitten verschiedener Sequenzen besteht, ist als gesonderte Sequenz mit eigener Sequenzkennzahl zu nummerieren. Sequenzen mit einer oder mehreren Lücken sind als mehrere gesonderte Sequenzen mit eigenen Sequenzkennzahlen zu nummerieren, wobei die Zahl der gesonderten Sequenzen der Zahl der jeweils zusammenhängenden Sequenzdatenreihen entspricht.

Sonstige verfügbare Angaben im Sequenzprotokoll
  1. 22.

    Die Angaben sind im Sequenzprotokoll in der Reihenfolge anzugeben, in der sie in der Liste der numerischen Kennzahlen der Datenelemente in Nr. 47 aufgeführt sind.

  2. 23.

    Für die Angaben im Sequenzprotokoll sind nur die in Nr. 47 aufgeführten numerischen Kennzahlen, nicht aber die dazugehörigen Beschreibungen zu verwenden. Die Angaben müssen unmittelbar auf die numerische Kennzahl folgen; im Sequenzprotokoll brauchen nur diejenigen numerischen Kennzahlen angegeben zu werden, zu denen auch Angaben vorliegen. Die einzigen beiden Ausnahmen zu dieser Vorschrift bilden die numerischen Kennzahlen <220> und <300>, die für die Rubrik "Merkmal" bzw. "Veröffentlichungsangaben" stehen und mit den Angaben unter den numerischen Kennzahlen <221> bis <223> bzw. <301> bis <313> zusammenhängen. Werden unter diesen numerischen Kennzahlen im Sequenzprotokoll Angaben zu den Merkmalen oder zur Veröffentlichung gemacht, so sollte auch die numerische Kennzahl <220> bzw. <300> aufgeführt, die dazugehörige Rubrik aber nicht ausgefüllt werden. Generell sollte zwischen den numerischen Kennzahlen eine Leerzeile eingefügt werden, wenn sich die an erster oder zweiter Position der numerischen Kennzahl stehende Ziffer ändert. Eine Ausnahme von dieser allgemeinen Regel bildet die numerische Kennzahl <310>, der keine Leerzeile vorausgehen darf. Auch vor jeder Wiederholung der numerischen Kennzahl ist eine Leerzeile einzufügen.

Obligatorische Datenelemente
  1. 24.

    In das Sequenzprotokoll sind außerdem vor der eigentlichen Nucleotid- und/oder Aminosäuresequenz die folgenden in Nr. 47 definierten Angaben (obligatorische Datenelemente) aufzunehmen:

    <110>Name des Anmelders
    <120>Bezeichnung der Erfindung
    <160>Anzahl der SEQ ID NOs
    <210>SEQ ID NO: x
    <211>Länge
    <212>Art
    <213>Organismus
    <400>Sequenz

    Ist der Name des Anmelders (numerische Kennzahl <110>) nicht in Buchstaben des lateinischen Alphabets geschrieben, so ist er - im Wege der Transliteration oder der Übersetzung ins Englische - auch in lateinischen Buchstaben anzugeben.

    Die Datenelemente mit Ausnahme der Angaben unter den numerischen Kennzahlen <110>, <120> und <160> sind für jede im Sequenzprotokoll aufgeführte Sequenz zu wiederholen. Gibt es zu einer Sequenzkennzahl keine Sequenz, so müssen nur die Datenelemente unter den numerischen Kennzahlen <210> und <400> angegeben werden (siehe Nr. 4 und SEQ ID NO: 4 in dem am Ende dieses Standards enthaltenen Beispiel).

  2. 25.

    In Sequenzprotokolle, die zusammen mit der dazugehörigen Anmeldung oder vor Vergabe einer Anmeldenummer eingereicht werden, ist neben den unter Nr. 24 genannten Datenelementen auch das Folgende aufzunehmen:

    <130>Bezugsnummer
  3. 26.

    In Sequenzprotokolle, die auf Aufforderung einer zuständigen Behörde oder nach Vergabe einer Anmeldenummer eingereicht werden, sind neben den unter Nr. 24 genannten Datenelementen auch die Folgenden aufzunehmen:

    <140>Vorliegende Patentanmeldung
    <141>Anmeldetag der vorliegenden Anmeldung
  4. 27.

    In Sequenzprotokolle, die zu einer Anmeldung eingereicht werden, die die Priorität einer früheren Anmeldung in Anspruch nimmt, sind neben den unter Nr. 24 genannten Datenelementen auch die Folgenden aufzunehmen:

    <150>Frühere Patentanmeldung
    <151>Anmeldetag der früheren Anmeldung
  5. 28.

    Wird in der Sequenz "n", "Xaa" oder eine modifizierte Base oder modifizierte/seltene L-Aminosäure aufgeführt, so müssen die folgenden Datenelemente angegeben werden:

    <220>Merkmal
    <221>Name/Schlüssel
    <222>Lage
    <223>Sonstige Informationen
  6. 29.

    Ist der Organismus (numerische Kennzahl <213>) eine "künstliche Sequenz" oder "unbekannt", so müssen die folgenden Datenelemente angegeben werden:

    <220>Merkmal
    <223>Sonstige Angaben
Fakultative Datenelemente
  1. 30.

    Alle in Nr. 47 definierten Datenelemente, die unter Nr. 24 bis 29 nicht erwähnt sind, sind fakultativ (fakultative Datenelemente).

Angabe von Merkmalen
  1. 31.

    Merkmale, die (unter der numerischen Kennzahl <220>) zu einer Sequenz angegeben werden, sind durch die in Nr. 48, Tabellen 5 und 6 1) aufgeführten "Merkmalschlüssel" zu beschreiben.

Freier Text
  1. 32.

    Unter "freiem Text" ist eine verbale Beschreibung der Eigenschaften der Sequenz ohne Verwendung des sprachneutralen Vokabulars im Sinne der Nr. 1 vii) unter der numerischen Kennzahl <223> (Sonstige Angaben) zu verstehen.

  2. 33.

    Der freie Text sollte sich auf einige kurze, für das Verständnis der Sequenz unbedingt notwendige Begriffe beschränken. Er sollte für jedes Datenelement nicht länger als 4 Zeilen sein und höchstens 65 Buchstaben pro Zeile umfassen. Alle weiteren Angaben sind in den Hauptteil der Beschreibung in der dort verwendeten Sprache aufzunehmen.

  3. 34.

    Freier Text kann in deutscher oder in englischer Sprache abgefasst sein.

  4. 35.

    Enthält das Sequenzprotokoll, das Bestandteil der Beschreibung ist, freien Text, so ist dieser im Hauptteil der Beschreibung in der dort verwendeten Sprache zu wiederholen. Es wird empfohlen, den in der Sprache des Hauptteils der Beschreibung abgefassten freien Text in einen besonderen Abschnitt der Beschreibung mit der Überschrift "Sequenzprotokoll - freier Text" aufzunehmen.

Nachgereichtes Sequenzprotokoll
  1. 36.

    Ein Sequenzprotokoll, das nicht Teil der eingereichten Anmeldung war, sondern nachträglich eingereicht wurde, darf nicht über den Offenbarungsgehalt der in der Anmeldung angegebenen Sequenzen hinausgehen. Dem nachgereichten Sequenzprotokoll muss eine Erklärung, die dies bestätigt, beigefügt sein. Das heißt, dass ein Sequenzprotokoll, das nachträglich eingereicht wurde, nur die Sequenzen beinhalten darf, die auch in der eingereichten Anmeldung aufgeführt sind.

  2. 37.

    Sequenzprotokolle, die nicht zusammen mit der Anmeldung eingereicht worden sind, sind nicht Teil der Offenbarung der Erfindung. Gemäß § 11 Abs. 3 besteht die Möglichkeit, Sequenzprotokolle, die zusammen mit der Anmeldung eingereicht wurden, im Wege der Mängelbeseitigung zu berichtigen.

Sequenzprotokoll in maschinenlesbarer Form
  1. 38.

    Das in der Anmeldung enthaltene Sequenzprotokoll ist zusätzlich auch in maschinenlesbarer Form einzureichen.

  2. 39.

    Das zusätzlich eingereichte maschinenlesbare Sequenzprotokoll muss mit dem geschriebenen Protokoll identisch sein und ist zusammen mit einer Erklärung folgenden Wortlauts einzureichen: "Die in maschinenlesbarer Form aufgezeichneten Angaben sind mit dem geschriebenen Sequenzprotokoll identisch."

  3. 40.

    Das gesamte ausdruckbare Exemplar des Sequenzprotokolls muss in einer einzigen Datei enthalten sein, die nach Möglichkeit auf einer einzigen Diskette oder einem sonstigen vom Deutschen Patent- und Markenamt akzeptierten elektronischen Datenträger aufgezeichnet sein soll. Diese Datei ist mittels der IBM 2) -Codetabellen (Code Page) 437, 932 3) oder einer kompatiblen Codetabelle zu codieren. Eine Codetabelle, wie sie z.B. für japanische, chinesische, kyrillische, arabische, griechische oder hebräische Schriftzeichen benötigt wird, gilt als kompatibel, wenn sie das lateinische Alphabet und die arabischen Ziffern denselben Hexadezimalpositionen zuordnet, wie die genannten Codetabellen.

  4. 41.

    Folgende Medientypen und Formatierungen für zusätzlich in maschinenlesbarer Form eingereichte Sequenzprotokolle werden akzeptiert:

    Physikalisches MediumTypFormatierung
       
    CD-R120 mm Recordable DiskISO 9660
    DVD-R120 mm DVD-Recordable Disk (4,7 GB)konform zu ISO 9660 oder OSTA UDF (1.02 oder höher)
    DVD+R120 mm DVD-Recordable Disk (4,7 GB)konform zu ISO 9660 oder OSTA UDF (1.02 oder höher).
  5. 42.

    Die maschinenlesbare Fassung kann mit beliebigen Mitteln erstellt werden. Sie muss aber den vom Deutschen Patent- und Markenamt angegebenen Formaten entsprechen. Vorzugsweise sollte zum Erstellen eine dafür vorgesehene spezielle Software, wie z.B. PatentIn verwendet werden.

  6. 43.

    Bei Verwendung von physikalischen Datenträgern ist eine Datenkompression erlaubt, sofern die komprimierte Datei in einem selbstextrahierenden Format erstellt worden ist, das sich auf einem vom Deutschen Patent- und Markenamt angegebenen Betriebssystem (MS Windows) selbst dekomprimiert. Ebenso können inhaltlich zusammengehörige Dateien in einem sich nicht selbstextrahierenden Format komprimiert sein, wenn die Archivdatei im Zip-Format der Version vom 13. Juli 1998 vorliegt und weder andere Zip-Archive oder eine Verzeichnisstruktur beinhaltet.

  7. 44.

    Auf dem physikalischen Datenträger ist ein Etikett fest anzubringen, auf dem von Hand oder mit der Maschine in Blockschrift der Name des Anmelders, die Bezeichnung der Erfindung, eine Bezugsnummer, der Zeitpunkt der Aufzeichnung der Daten und das Computerbetriebssystem eingetragen sind.

  8. 45.

    Wird der physikalische Datenträger erst nach dem Tag der Anmeldung eingereicht, so sind auf den Etiketten auch der Anmeldetag und die Anmeldenummer anzugeben. Korrekturen oder Änderungen zum Sequenzprotokoll sind sowohl schriftlich als auch in maschinenlesbarer Form einzureichen.

  9. 46.

    Jede Korrektur der ausgedruckten Version des Sequenzprotokolls, die auf Grund der PCT Regel 13ter.1(a)(i) oder 26.3 eingereicht, jede Verbesserung eines offensichtlichen Fehlers in der ausgedruckten Version, die auf Basis der PCT Regel 91 eingereicht und jeder Zusatz, der nach Artikel 34 PCT in die ausgedruckte Version des Sequenzprotokolls eingebunden wurde, muss zusätzlich in einer verbesserten und mit den Zusätzen versehenen Version des Sequenzprotokolls in maschinenlesbarer Form eingereicht werden.

  10. 47.

    Numerische Kennzahlen

    In Sequenzprotokollen, die zu Anmeldungen eingereicht werden, dürfen nur die nachstehenden numerischen Kennzahlen verwendet werden. Die Überschriften der nachstehenden Datenelementrubriken dürfen in den Sequenzprotokollen nicht erscheinen. Die numerischen Kennzahlen der obligatorischen Datenelemente, d.h. der Datenelemente, die in alle Sequenzprotokolle aufgenommen werden müssen (siehe Nr. 24 dieses Standards: Kennziffern 110, 120, 160, 210, 211, 212, 213 und 400), und die numerischen Kennzahlen der Datenelemente, die in den in diesem Standard genannten Fällen aufgenommen werden müssen (siehe Nr. 25, 26, 27, 28 und 29 dieses Standards: Kennzahlen 130, 140, 141, 150 und 151 sowie 220 bis 223), sind mit dem Buchstaben "O" gekennzeichnet.

    Die numerischen Kennzahlen der fakultativen Datenelemente (siehe Nr. 30 dieses Standards) sind mit dem Buchstaben "F" gekennzeichnet.

    Zulässige numerische Kennzahlen
    Numerische KennzahlNumerische Kennzahl BeschreibungObligatorisch (O) oder fakultativ (F)Bemerkungen
    <110>Name des AnmeldersOIst der Name des Anmelders nicht in lateinischen Buchstaben geschrieben, so muss er - im Wege der Transliteration oder der Übersetzung ins Englische - auch in lateinischen Buchstaben angegeben werden
    <120>Bezeichnung der ErfindungO 
    <130>BezugsnummerO in den Fällen nach Nr. 25 StandardSiehe Nr. 25 Standard
    <140>Vorliegende PatentanmeldungO in den Fällen nach Nr. 26 StandardSiehe Nr. 26 Standard; die vorliegende Patentanmeldung ist zu kennzeichnen durch den zweibuchstabigen Code nach dem WIPO-Standard ST. 3, gefolgt von der Anmeldenummer (in dem Format, das von der Behörde für gewerblichen Rechtsschutz verwendet wird, bei der diese Patentanmeldung eingereicht wird) oder - bei internationalen Anmeldungen - von der internationalen Anmeldenummer
    <141>Anmeldetag der vorliegenden AnmeldungO in den Fällen nach Nr. 26 StandardSiehe Nr. 26 Standard; das Datum ist entsprechend dem WIPO-Standard ST. 2 anzugeben (CCYY MM DD)
    <150>Frühere PatentanmeldungO in den Fällen nach Nr. 27 StandardSiehe Nr. 27 Standard; die frühere Patentanmeldung ist zu kennzeichnen durch den zweibuchstabigen Code entsprechend dem WIPO-Standard ST. 3, gefolgt von der Anmeldenummer (in dem Format, das von der Behörde für gewerblichen Rechtsschutz verwendet wird, bei der die frühere Patentanmeldung eingereicht wurde) oder - bei internationalen Anmeldungen - von der internationalen Anmeldenummer
    <151>Anmeldetag der früheren AnmeldungO in den Fällen nach Nr. 27 StandardSiehe Nr. 27 Standard; das Datum ist entsprechend dem WIPO-Standard ST. 2 anzugeben (CCYY MM DD)
    <160>Anzahl der SEQ ID NOsO 
    <170>SoftwareF 
    <210>Angaben zu SEQ ID NO: xOAnzugeben ist eine ganze Zahl, die die SEQ ID NO darstellt
    <211>LängeOSequenzlänge, ausgedrückt als Anzahl der Basen oder Aminosäuren
    <212>ArtOArt des in SEQ ID NO: x sequenzierten Moleküls, und zwar entweder DNA, RNA oder PRT; enthält eine Nucleotidsequenz sowohl DNA- als auch RNA-Fragmente, so ist "DNA" anzugeben; zusätzlich ist das kombinierte DNA-/RNA-Molekül im Merkmalsteil unter <220> bis <223> näher zu beschreiben
    <213>OrganismusOGattung/Art (d.h. wissenschaftlicher Name), "künstliche Sequenz" oder "unbekannt"
    <220>MerkmalO in den Fällen nach Nr. 28 und 29 StandardFreilassen; siehe Nr. 28 und 29 Standard; Beschreibung biologisch signifikanter Stellen in der Sequenz gemäß SEQ ID NO: x (kann je nach der Zahl der angegebenen Merkmale mehrmals vorkommen)
    <221>Name/SchlüsselO in den Fällen nach Nr. 28 StandardSiehe Nr. 28 Standard; es dürfen nur die in Nr. 48, Tabelle 5 oder 6 beschriebenen Schlüssel verwendet werden
    <222>LageO in den Fällen nach Nr. 28 StandardSiehe Nr. 28 Standard;
       -von (Nummer der ersten Base/Aminosäure des Merkmals)
       -bis (Nummer der letzten Base/Aminosäure des Merkmals)
       -Basen (Ziffern verweisen auf die Positionen der Basen in einer Nucleotidsequenz)
       -Aminosäuren (Ziffern verweisen auf die Positionen der Aminosäurereste in einer Aminosäuresequenz)
       -Angabe, ob sich das Merkmal auf dem zum Strang des Sequenzprotokolls komplementären Strang befindet
    <223>Sonstige AngabenO in den Fällen nach Nr. 28 und 29 StandardSiehe Nr. 28 und 29 Standard; sonstige relevante Angaben, wobei sprachneutrales Vokabular oder freier Text (in deutscher oder in englischer Sprache) zu verwenden ist; freier Text ist im Hauptteil der Beschreibung in der dort verwendeten Sprache zu wiederholen (siehe Nr. 35 Standard); enthält die Sequenz eine der in Nr. 48, Tabellen 2 und 4 aufgeführten modifizierten Basen oder modifizierten/seltenen L-Aminosäuren, so ist für diese Base oder Aminosäure das dazugehörige Symbol aus Nr. 48, Tabellen 2 und 4 zu verwenden
    <300>Veröffentlichungs-
    angaben
    FFreilassen; dieser Abschnitt ist für jede relevante Veröffentlichung zu wiederholen
    <301>VerfasserF 
    <302>TitelFTitel der Veröffentlichung
    <303>ZeitschriftFName der Zeitschrift, in der die Daten veröffentlicht wurden
    <304>BandFBand der Zeitschrift, in dem die Daten veröffentlicht wurden
    <305>HeftFNummer des Hefts der Zeitschrift, in dem die Daten veröffentlicht wurden
    <306>SeitenFSeiten der Zeitschrift, auf denen die Daten veröffentlicht wurden
    <307>DatumFDatum der Zeitschrift, an dem die Daten veröffentlicht wurden; Angabe nach Möglichkeit entsprechend dem WIPO-Standard ST. 2 (CCYY MM DD)
    <308>Eingangsnummer in der DatenbankFVon der Datenbank zugeteilte Eingangsnummer einschließlich Datenbankbezeichnung
    <309>Datenbank-EingabedatumFDatum der Eingabe in die Datenbank; Angabe entsprechend dem WIPO-Standard ST. 2 (CCYY MM DD)
    <310>DokumentennummerFNummer des Dokuments, nur bei Patentdokumenten; die vollständige Nummer hat nacheinander Folgendes zu enthalten: den zweibuchstabigen Code entsprechend dem WIPO-Standard ST. 3, die Veröffentlichungsnummer entsprechend dem WIPO-Standard ST. 6 und den Code für die Dokumentenart nach dem WIPO-Standard ST. 16
    <311>AnmeldetagFAnmeldetag des Dokuments, nur bei Patentdokumenten; Angabe entsprechend WIPO-Standard ST. 2 (CCYY MM DD)
    <312>VeröffentlichungsdatumFDatum der Veröffentlichung des Dokuments; nur bei Patentdokumenten; Angabe entsprechend WIPO-Standard ST. 2 (CCYY MM DD)
    <313>Relevante Reste in
    SEQ ID NO: x von bis
    F 
    <400>SequenzOSEQ ID NO: x sollte in der der Sequenz vorausgehenden Zeile hinter der numerischen Kennzahl stehen (siehe Beispiel)
  11. 48.

    Symbole für Nucleotide und Aminosäuren und Merkmalstabellen

    Tabelle 1
    Liste der Nucleotide
    SymbolBedeutungAbleitung der Bezeichnung
       
    aaAdenin
       
    ggGuanin
       
    ccCytosin
       
    ttThymin
       
    uuUracil
       
    rg oder aPurin
       
    yt/u oder cPyrimidin
       
    ma oder cAmino
       
    kg oder t/uKeto
       
    sg oder cstarke Bindungen, 3 H-Brücken
       
    wa oder t/uschwache (e: weak) Bindungen,
    2 H-Brücken
       
    bg oder c oder t/unicht a
       
    da oder g oder t/unicht c
       
    ha oder c oder t/unicht g
       
    va oder g oder cnicht t, nicht u
       
    na oder g oder c oder t/u, unbekannt oder sonstigebeliebig (e: any)



    Tabelle 2
    Liste der modifizierten Nucleotide
    SymbolBedeutung
      
    ac4c4-Acetylcytidin
      
    chm5u5-(Carboxyhydroxymethyl)uridin
      
    cm2'-O-Methylcytidin
      
    cmnm5s2u5-Carboxymethylaminomethyl-2-thiouridin
      
    cmnm5u5-Carboxymethylaminomethyluridin
      
    dDihydrouridin
      
    fm2'-O-Methylpseudouridin
      
    gal qbeta,D-Galactosylqueuosin
      
    gm2'-O-Methylguanosin
      
    iInosin
      
    i6aN6-Isopentenyladenosin
      
    m1a1-Methyladenosin
      
    m1f1-Methylpseudouridin
      
    m1g1-Methylguanosin
      
    m1i1-Methylinosin
      
    m22g2,2-Dimethylguanosin
      
    m2a2-Methyladenosin
      
    m2g2-Methylguanosin
      
    m3c3-Methylcytidin
      
    m5c5-Methylcytidin
      
    m6aN6-Methyladenosin
      
    m7g7-Methylguanosin
      
    mam5u5-Methylaminomethyluridin
      
    mam5s2u5-Methoxyaminomethyl-2-thiouridin
      
    man qbeta,D-Mannosylqueuosin
      
    mcm5s2u5-Methoxycarbonylmethyl-2-thiouridin
      
    mcm5u5-Methoxycarbonylmethyluridin
      
    mo5u5-Methoxyuridin
      
    ms2i6a2-Methylthio-N6-isopentenyladenosin
      
    ms2t6aN-((9-beta-D-Ribofuranosyl-2-methylthiopurin-6-yl)carbamoyl)threonin
      
    mt6aN-((9-beta-D-Ribofuranosylpurin-6-yl)N-methylcarbamoyl)threonin
      
    mvUridin-5-oxyessigsäuremethylester
      
    o5uUridin-5-oxyessigsäure(v)
      
    osywWybutoxosin
      
    pPseudouridin
      
    qQueuosin
      
    s2c2-Thiocytidin
      
    s2t5-Methyl-2-thiouridin
      
    s2u2-Thiouridin
      
    s4u4-Thiouridin
      
    t5-Methyluridin
      
    t6aN-((9-beta-D-Ribofuranosylpurin-6-yl)carbamoyl)threonin
      
    tm2'-O-Methyl-5-methyluridin
      
    um2'-O-Methyluridin
      
    ywWybutosin
      
    x3-(3-Amino-3-carboxypropyl)uridin,(acp3)u



    Tabelle 3
    Liste der Aminosäuren
    SymbolBedeutung
      
    AlaAlanin
      
    CysCystein
      
    AspAsparaginsäure
      
    GluGlutaminsäure
      
    PhePhenylalanin
      
    GlyGlycin
      
    HisHistidin
      
    IleIsoleucin
      
    LysLysin
      
    LeuLeucin
      
    MetMethionin
      
    AsnAsparagin
      
    ProProlin
      
    GlnGlutamin
      
    ArgArginin
      
    SerSerin
      
    ThrThreonin
      
    ValValin
      
    TrpTryptophan
      
    TyrTyrosin
      
    AsxAsp oder Asn
      
    GlxGlu oder Gln
      
    XaaUnbekannt oder sonstige



    Tabelle 4
    Liste der modifizierten und seltenen Aminosäuren
    SymbolBedeutung
      
    Aad2-Aminoadipinsäure
      
    bAad3-Aminoadipinsäure
      
    bAlabeta-Alanin, beta-Aminopropionsäure
      
    Abu2-Aminobuttersäure
      
    4Abu4-Aminobuttersäure, Piperidinsäure
      
    Acp6-Aminocapronsäure
      
    Ahe2-Aminoheptansäure
      
    Aib2-Aminoisobuttersäure
      
    bAib3-Aminoisobuttersäure
      
    Apm2-Aminopimelinsäure
      
    Dbu2,4-Diaminobuttersäure
      
    DesDesmosin
      
    Dpm2,2'-Diaminopimelinsäure
      
    Dpr2,3-Diaminopropionsäure
      
    EtGlyN-Ethylglycin
      
    EtAsnN-Ethylasparagin
      
    HylHydroxylysin
      
    aHylallo-Hydroxylysin
      
    3Hyp3-Hydroxyprolin
      
    4Hyp4-Hydroxyprolin
      
    IdeIsodesmosin
      
    aIleallo-Isoleucin
      
    MeGlyN-Methylglycin, Sarkosin
      
    MeIleN-Methylisoleucin
      
    MeLys6-N-Methyllysin
      
    MeValN-Methylvalin
      
    NvaNorvalin
      
    NleNorleucin
      
    OrnOrnithin



    Tabelle 5
    Liste der Merkmalschlüssel zu Nucleotidsequenzen
    SchlüsselBeschreibung
      
    allele ein verwandtes Individuum oder ein verwandter Stamm enthält stabile alternative Formen desselben Gens und unterscheidet sich an dieser (und vielleicht an anderer) Stelle von der vorliegenden Sequenz
    attenuator1.Region einer DNA, in der die Beendigung der Transkription reguliert wird und die Expression einiger bakterieller Operons gesteuert wird
     2.zwischen dem Promotor und dem ersten Strukturgen liegender Sequenzabschnitt, der eine partielle Beendigung der Transkription bewirkt
    C_regionkonstante Region der leichten und schweren Immunglobulinketten und der Alpha-, Beta- und Gamma-Ketten von T-Zell-Rezeptoren; enthält je nach Kette ein oder mehrere Exons
    CAAT_signalCAAT-Box; Teil einer konservierten Sequenz, der etwa 75 Basenpaare stromaufwärts vom Startpunkt der eukaryontischen Transkriptionseinheiten liegt und an der RNA-Polymerase-Bindung beteiligt sein kann; Konsensussequenz = GG (C oder T) CAATCT
    CDScodierende Sequenz; Sequenz von Nucleotiden, die mit der Sequenz der Aminosäuren in einem Protein übereinstimmt (beinhaltet Stopcodon); Merkmal schließt eine mögliche Translation der Aminosäure ein
    conflictunabhängige Bestimmungen "derselben" Sequenz unterscheiden sich an dieser Stelle oder in dieser Region voneinander
    D-loopD-Schleife; Region innerhalb der mitochondrialen DNA, in der sich ein kürzeres RNA-Stück mit einem Strang der doppelsträngigen DNA paart und dabei den ursprünglichen Schwesterstrang in dieser Region verdrängt; dient auch zur Beschreibung der Verdrängung einer Region des einen Stranges eines DNA-Doppelstrangs durch eine einzelsträngige Nucleinsäure bei der durch ein recA-Protein ausgelösten Reaktion
    D-segmentDiversity-Region der schweren Kette von Immunglobulin und der Beta-Kette eines T-Zell-Rezeptors
    enhancereine als Cis-Element wirkende Sequenz, die die Aktivität (einiger) eukaryontischer Promotoren verstärkt und in beliebiger Richtung und Position zum Promotor (stromaufwärts oder -abwärts) funktioniert
    exonRegion des Genoms, die für einen Teil der gespleißten mRNA codiert; kann 5'UTR, alle CDSs und 3'UTR enthalten
    GC_signalGC-Box; eine konservierte, GC-reiche Region stromaufwärts vom Startpunkt der eukaryontischen Transkriptionseinheiten, die in mehreren Kopien und in beiden Richtungen vorkommen kann; Konsensussequenz = GGGCGG
    genebiologisch signifikante Region, codierende Nucleinsäure
    iDNAintervenierende DNA; DNA, die durch verschiedene Arten der Rekombination eliminiert wird
    intronDNA-Abschnitt, der transkribiert, aber beim Zusammenspleißen der ihn umgebenden Sequenzen (Exons) aus dem Transkript wieder herausgeschnitten wird
    J_segmentJ-Kette (Verbindungskette) zwischen den leichten und den schweren Immunglobulinketten und den Alpha-, Beta- und Gamma-Ketten der T-Zell-Rezeptoren
    LTRlange, sich an den beiden Enden einer gegebenen Sequenz direkt wiederholende Sequenz, wie sie für Retroviren typisch ist
    mat_peptidefür ein reifes Peptid oder Protein codierende Sequenz; Sequenz, die für das reife oder endgültige Peptid- oder Proteinprodukt im Anschluss an eine posttranslationale Modifizierung codiert; schließt im Gegensatz zur entsprechenden CDS das Stopcodon nicht ein
    misc_bindingStelle in einer Nucleinsäure, die einen anderen Teil, der nicht durch einen anderen Bindungsschlüssel (primer_bind oder protein_bind) beschrieben werden kann, kovalent oder nicht kovalent bindet
    misc_differencedie Merkmalsequenz unterscheidet sich von der im Eintrag und kann nicht durch einen anderen Unterscheidungsschlüssel (conflict, unsure, old_sequence, mutation, variation, allele bzw. modified_base) beschrieben werden
    misc_featurebiologisch signifikante Region, die nicht durch einen anderen Merkmalschlüssel beschrieben werden kann; neues oder seltenes Merkmal
    misc_recombStelle, an der ein allgemeiner, ortsspezifischer oder replikativer Rekombinationsvorgang stattfindet, bei dem die DNA-Doppelhelix aufgebrochen und wieder zusammengefügt wird, und die nicht durch andere Rekombinationsschlüssel (iDNA oder Virion) oder den betreffenden Herkunftsschlüssel (/insertions_seq, /transposon, /proviral) beschrieben werden kann
    misc_RNATranskript oder RNA-Produkt, das nicht durch andere RNA-Schlüssel (prim_transcript, precursor_RNA, mRNA, 5'clip, 3'clip, 5'UTR, 3'UTR, exon, CDS, sig_peptide, transit_peptide, mat_peptide, intron, polyA_site, rRNA, tRNA, scRNA oder snRNA) beschrieben werden kann
    misc_signalRegion, die ein Signal enthält, das die Genfunktion oder -expression steuert oder ändert, und die nicht durch andere Signalschlüssel (promoter, CAAT_signal, TATA_signal, -35_signal, -10_signal, GC_signal, RBS, polyA_signal, enhancer, attenuator, terminator oder rep_origin) beschrieben werden kann
    misc_structureSekundär-, Tertiär- oder sonstige Struktur oder Konformation, die nicht durch andere Strukturschlüssel (stem_loop oder D-loop) beschrieben werden kann
    modified_basedas angegebene Nucleotid ist ein modifiziertes Nucleotid und ist durch das angegebene Molekül (ausgedrückt durch die modifizierte Base) zu ersetzen
    mRNAmessenger-RNA (Boten-RNA); enthält eine 5'-nichttranslatierte Region (5'UTR), codierende Sequenzen (CDS, Exon) und eine 3'-nichttranslatierte Region (3'UTR)
    mutationein verwandter Stamm weist an dieser Stelle eine plötzliche, erbliche Sequenzveränderung auf
    N_regionzusätzliche Nucleotide, die zwischen neu geordnete Immunglobulinabschnitte eingefügt werden
    old_sequencedie vorliegende Sequenz stellt eine geänderte Version der früher an dieser Stelle befindlichen Sequenz dar
    polyA_signalErkennungsregion, die zur Endonuclease-Spaltung eines RNA-Transkripts mit anschließender Polyadenylierung nötig ist; Konsensussequenz: AATAAA
    polyA_siteStelle auf einem RNA-Transkript, an der durch posttranslationale Polyadenylierung Adeninreste eingefügt werden
    precursor_RNAnoch nicht gereifte RNA-Spezies; kann eine am 5'-Ende abzuschneidende Region (5'Clip), eine 5'-nichttranslatierte Region (5'UTR), codierende Sequenzen (CDS, Exon), intervenierende Sequenzen (Intron), eine 3'-nichttranslatierte Region (3'UTR) und eine am 3'-Ende abzuschneidende Region (3'Clip) enthalten
    prim_transcriptprimäres (ursprüngliches, nicht prozessiertes) Transkript; enthält eine am 5'-Ende abzuschneidende Region (5'Clip), eine 5'-nichttranslatierte Region (5'UTR), codierende Sequenzen (CDS, Exon), intervenierende Sequenzen (Intron), eine 3'-nichttranslatierte Region (3'UTR) und eine am 3'-Ende abzuschneidende Region (3'Clip)
    primer_bindnichtkovalente Primer-Bindungsstelle für die Initiierung der Replikation, Transkription oder reversen Transkription; enthält eine oder mehrere Stellen für synthetische Elemente, z.B. PCR-Primerelemente
    promoterRegion auf einem DNA-Molekül, die an der Bindung der RNA-Polymerase beteiligt ist, die die Transkription initiiert
    protein_bindnichtkovalente Protein-Bindungsstelle auf der Nucleinsäure
    RBSribosomale Bindungsstelle
    repeat_regionGenomregion mit repetitiven Einheiten
    repeat_uniteinzelnes Repeat (repetitive Einheit)
    rep_originReplikationsursprung; Startpunkt der Duplikation der Nucleinsäure, durch die zwei identische Kopien entstehen
    rRNAreife ribosomale RNA; RNA-Komplex des Ribonucleoprotein-Partikels (Ribosom), der Aminosäuren zu Proteinen zusammenfügt
    S_regionSwitch-Region der schweren Immunglobulinketten; beteiligt am Umbau der DNA von schweren Ketten, der zur Expression einer anderen Immunglobulin-Klasse aus derselben B-Zelle führt
    satelliteviele tandemartig hintereinander geschaltete (identische oder verwandte) Repeats einer kurzen grundlegenden repetitiven Einheit; viele davon unterscheiden sich in der Basenzusammensetzung oder einer anderen Eigenschaft vom Genomdurchschnitt und können so von der Hauptmasse der genomischen DNA abgetrennt werden
    scRNAkleine cytoplasmische RNA; eines von mehreren kleinen cytoplasmischen RNA-Molekülen im Cytoplasma und (manchmal) im Zellkern eines Eukaryonten
    sig_peptidefür ein Signalpeptid codierende Sequenz; Sequenz, die für eine N-terminale Domäne eines sekretorischen Proteins codiert; diese Domäne spielt bei der Anheftung des nascierenden Polypeptids an die Membran eine Rolle; Leader-Sequenz
    snRNAkleine Kern-RNA; eine der vielen kleinen RNA-Formen, die nur im Zellkern vorkommen; einige der snRNAs spielen beim Spleißen oder bei anderen RNA-verarbeitenden Reaktionen eine Rolle
    sourcebezeichnet die biologische Herkunft des genannten Sequenzabschnitts; die Angabe dieses Schlüssels ist obligatorisch; jeder Eintrag muss mindestens einen Herkunftsschlüssel aufweisen, der die gesamte Sequenz umfasst; es dürfen zu jeder Sequenz auch mehrere Herkunftsschlüssel angegeben werden
    stem_loopHaarnadelschleife; eine Doppelhelix-Region, die durch Basenpaarung zwischen benachbarten (invertierten) komplementären Sequenzen in einem RNA- oder DNA-Einzelstrang entsteht
    STSSequence Tagged Site; kurze, nur als Einzelkopie vorkommende DNA-Sequenz, die einen Kartierungspunkt auf dem Genom bezeichnet und durch PCR ermittelt werden kann; eine Region auf dem Genom kann durch Bestimmung der Reihenfolge der STSs kartiert werden
    TATA_signalTATA-Box; Goldberg-Hogness-Box; ein konserviertes AT-reiches Septamer, das sich rund 25 Basenpaare vor dem Startpunkt jeder eukaryontischen RNA-Polymerase-II-Transkriptionseinheit befindet und bei der Positionierung des Enzyms für eine korrekte Initiation eine Rolle spielen kann; Konsensussequenz = TATA (A oder T) A (A oder T)
    terminatorDNA-Sequenz, die entweder am Ende des Transkripts oder neben einer Promotor-Region liegt und bewirkt, dass die RNA-Polymerase die Transkription beendet; kann auch die Bindungsstelle eines Repressor-Proteins sein
    transit_peptidefür Transitpeptid codierende Sequenz; Sequenz, die für eine N-terminale Domäne eines im Zellkern codierten Organellen-Proteins codiert; diese Domäne ist an der posttranslationalen Einschleusung des Proteins in die Organelle beteiligt
    tRNAreife transfer-RNA, ein kleines RNA-Molekül (75 - 85 Basen lang), das die Translation einer Nucleinsäure-Sequenz in eine Aminosäure-Sequenz vermittelt
    unsureder Autor kennt die Sequenz in dieser Region nicht genau
    V_regionvariable Region der leichten und schweren Immunglobulinketten sowie der Alpha-, Beta- und Gamma-Ketten von T-Zell-Rezeptoren; codiert für das variable Aminoende; kann aus V-, D-, N- und J-Abschnitten bestehen
    V_segmentvariabler Abschnitt der leichten und schweren Immunglobulinketten sowie der Alpha-, Beta- und Gamma-Ketten von T-Zell-Rezeptoren; codiert für den Großteil der variablen Region (V_region) und die letzten Aminosäuren des Leader-Peptids
    variationein verwandter Stamm enthält stabile Mutationen desselben Gens (z.B. RFLPs, Polymorphismen usw.), die sich an dieser (und möglicherweise auch an anderer) Stelle von der vorliegenden Sequenz unterscheiden
    3'clip3'-äußerste Region eines Precursor-Transkripts, die bei der Prozessierung abgeschnitten wird
    3'UTRRegion am 3'-Ende eines reifen Transkripts (nach dem Stopcodon), die nicht in ein Protein translatiert wird
    5'clip5'-äußerste Region eines Precursor-Transkripts, die bei der Prozessierung abgeschnitten wird
    5'UTRRegion am 5'-Ende eines reifen Transkripts (vor dem Initiationscodon), die nicht in ein Protein translatiert wird
    -10_signalPribnow-Box; konservierte Region rund 10 Basenpaare stromaufwärts vom Startpunkt der bakteriellen Transkriptionseinheiten, die bei der Bindung der RNA-Polymerase eine Rolle spielt; Konsensussequenz = TAtAaT
    -35_signalkonserviertes Hexamer rund 35 Basenpaare stromaufwärts vom Startpunkt der bakteriellen Transkriptionseinheiten; Konsensussequenz = TTGACa oder TGTTGACA



    Tabelle 6
    Liste der Merkmalschlüssel zu Proteinsequenzen
    SchlüsselBeschreibung
      
    CONFLICTin den einzelnen Unterlagen ist von verschiedenen Sequenzen die Rede
    VARIANTden Angaben der Autoren zufolge gibt es Sequenzvarianten
    VARSPLICBeschreibung von Sequenzvarianten, die durch alternatives Spleißen entstanden sind
    MUTAGENexperimentell veränderte Stelle
    MOD_RESposttranslationale Modifikation eines Rests
    ACETYLATIONN-terminale oder sonstige
    AMIDATIONin der Regel am C-Terminus eines reifen aktiven Peptids
    BLOCKEDunbestimmte Gruppe, die das N- oder C-terminale Ende blockiert
    FORMYLATIONdes N-terminalen Methionin
    GAMMA-CARBOXYGLUTAMIC
    ACID HYDROXYLATION
    von Asparagin, Asparaginsäure, Prolin oder Lysin
    METHYLATIONin der Regel von Lysin oder Arginin
    PHOSPORYLATIONvon Serin, Threonin, Tyrosin, Asparaginsäure oder Histidin
    PYRROLIDONE
    CARBOXYLIC ACID
    N-terminales Glutamat, das ein internes cyclisches Lactam gebildet hat
    SULFATATIONin der Regel von Tyrosin
    LIPIDkovalente Bindung eines Lipidanteils
    MYRISTATEMyristat-Gruppe, die durch eine Amidbindung an den N-terminalen Glycin-Rest der reifen Form eines Proteins oder an einen internen Lysin-Rest gebunden ist
    PALMITATEPalmitat-Gruppe, die durch eine Thioetherbindung an einen Cystein-Rest oder durch eine Esterbindung an einen Serin- oder Threonin-Rest gebunden ist
    FARNESYLFarnesyl-Gruppe, die durch eine Thioetherbindung an einen Cystein-Rest gebunden ist
    GERANYL-GERANYLGeranyl-geranyl-Gruppe, die durch eine Thioetherbindung an einen Cystein-Rest gebunden ist
    GPI-ANCHORGlykosyl-phosphatidylinositol-(GPI-)Gruppe, die an die alpha-Carboxylgruppe des C-terminalen Rests der reifen Form eines Proteins gebunden ist
    N-ACYL DIGLYCERIDEN-terminales Cystein der reifen Form eines prokaryontischen Lipoproteins mit einer amidgebundenen Fettsäure und einer Glyceryl-Gruppe, an die durch Esterbindungen zwei Fettsäuren gebunden sind
    DISULFIDDisulfidbindung; den "VON"- und den "BIS"-Endpunkt bilden die beiden Reste, die durch eine ketteninterne Disulfidbindung verbunden sind; sind der "VON"- und der "BIS"-Endpunkt identisch, ist die Disulfidbindung kettenübergreifend, und die Art der Quervernetzung ist im Beschreibungsfeld anzugeben
    THIOLESTThiolesterbindung; den "VON"- und den "BIS"-Endpunkt bilden die beiden Reste, die durch die Thiolesterbindung verbunden sind
    THIOETHThioetherbindung; den "VON"- und den "BIS"-Endpunkt bilden die beiden Reste, die durch die Thioetherbindung verbunden sind
    CARBOHYDGlykosylierungs-Stelle; die Art des Kohlenhydrats (sofern bekannt) ist im Beschreibungsfeld anzugeben
    METALBindungsstelle für ein Metallion; die Art des Metalls ist im Beschreibungsfeld anzugeben
    BINDINGBindungsstelle für eine beliebige chemische Gruppe (Coenzym, prosthetische Gruppe usw.); die Art der Gruppe ist im Beschreibungsfeld anzugeben
    SIGNALBereich einer Signalsequenz (Präpeptid)
    TRANSITBereich eines Transit-Peptids (mitochondriales, chloroplastidäres oder für Microbodies)
    PROPEPBereich eines Propeptids
    CHAINBereich einer Polypeptid-Kette im reifen Protein
    PEPTIDEBereich eines freigesetzten aktiven Peptids
    DOMAINBereich einer wichtigen Domäne auf der Sequenz; die Art dieser Domäne ist im Beschreibungsfeld anzugeben
    CA_BINDBereich einer Calcium-bindenden Region
    DNA_BINDBereich einer DNA-bindenden Region
    NP_BINDBereich einer Nucleotidphosphat-bindenden Region; die Art des Nucleotidphosphats ist im Beschreibungsfeld anzugeben
    TRANSMEMBereich einer Transmembran-Region
    ZN_FINGBereich einer Zink-Finger-Region
    SIMILARGrad der Ähnlichkeit mit einer anderen Proteinsequenz; im Beschreibungsfeld sind genaue Angaben über diese Sequenz zu machen
    REPEATBereich einer internen Sequenzwiederholung
    HELIXSekundärstruktur: Helices, z.B. Alpha-Helix, 3(10)-Helix oder Pi-Helix
    STRANDSekundärstruktur: Beta-Strang, z.B. durch Wasserstoff-Brückenbindungen stabilisierter Beta-Strang, oder Rest in einer isolierten Beta-Brücke
    TURNSekundärstruktur: Schleife, z.B. durch Wasserstoff-Brückenbindungen stabilisierte Schleife (3-, 4- oder 5-Schleife)
    ACT_SITEAminosäure(n), die bei der Aktivität eines Enzyms mitwirkt (mitwirken)
    SITEirgendeine andere wichtige Stelle auf der Sequenz
    INIT_METdie Sequenz beginnt bekanntermaßen mit einem Start-Methionin
    NON_TERder Rest am Sequenzanfang oder -ende ist nicht der Terminalrest; steht er an der Position 1, so bedeutet das, dass diese nicht der N-Terminus des vollständigen Moleküls ist; steht er an letzter Position, so ist diese Position nicht der C-Terminus des vollständigen Moleküls; für diesen Schlüssel gibt es kein Beschreibungsfeld
    NON_CONSnicht aufeinander folgende Reste; zeigt an, dass zwei Reste in einer Sequenz nicht aufeinander folgen, sondern dass zwischen ihnen einige nichtsequenzierte Reste liegen
    UNSUREUnsicherheiten in der Sequenz; mit diesem Schlüssel werden Regionen einer Sequenz beschrieben, bei der sich der Autor bezüglich der Sequenzzuweisung nicht sicher ist

Beispiel:

<110> Smith, John; Smithgene Inc.
<120> Beispiel für ein Sequenzprotokoll
<130> 01-00001
<140> PCT / EP98 / 00001
<141> 1998-12-31
<150> US 08 / 999,999
<151> 1997-10-15
<160> 4
<170> PatentIn Version 2.0
<210> 1
<211> 389
<212> DNA
<213> Paramecium sp.
<220>
<221> CDS
<222> (279) ... (389)
<300>
<301> Doe, Richard
<302> Isolation and Characterization of a Gene Encoding a Protease from Paramecium sp.
<303> Journal of Genes
<304> 1
<305> 4
<306> 1-7
<307> 1988-06-31
<308> 123456
<309> 1988-06-31
<400> 1

agctgtagtcattcctgtgtcctcttctctctgggcttctcaccctgctaatcagatctc60
agggagagtgtcttgaccctcctctgcctttgcagcttcacaggcaggcaggcaggcagc120
tgatgtggcaattgctggcagtgccacaggcttttcagccaggcttagggtgggttccgc180
cgcggcgcggcggcccctctcgcgctcctctcgcgcctctctctcgctctcctctcgctc240
ggacctgattaggtgagcaggaggagggggcagttagcatg
Met
1
gtt
Val
tca
Ser
atg
Met
ttc
Phe
5
agc
Ser
296
ttg
Leu
tct
Ser
ttc
Phe
aaa
Lys
10
tgg
Trp
cct
Pro
gga
Gly
ttt
Phe
tgt
Cys
15
ttg
Leu
ttt
Phe
gtt
Val
tgt
Cys
ttg
Leu
20
ttc
Phe
caa
Gln
344
                 
tgt
Cys
ccc
Pro
aaa
Lys
25
gtc
Val
ctc
Leu
ccc
Pro
tgt
Cys
cac
His
30
tca
Ser
tca
Ser
ctg
Leu
cag
Gln
ccg
Pro
35
aat
Asn
ctt
Leu
 389
1) Amtl. Anm.:

Diese Tabellen enthalten Auszüge aus den Merkmalstabellen "DDBJ/EMBL/Genbank Feature Table" (Nucleotidsequenzen) und "SWISS PROT Feature Table" (Aminosäuresequenzen).

2) Amtl. Anm.:

IBM ist eine für die International Business Machine Corporation, Vereinigte Staaten von Amerika, eingetragene Marke.

3) Amtl. Anm.:

Die genannten Codetabellen gelten für Personal Computer als de facto Standard.

Zu Anlage 1: Geändert durch V vom 11. 5. 2004 (BGBl I S. 897) und 17. 12. 2004 (BGBl I S. 3532).

Diese Artikel im Bereich Wirtschaft und Gewerbe könnten Sie interessieren

Haftung GmbH Geschäftsführer: 5 goldene Regeln und Haftungsvermeidungsstrategien

Haftung GmbH Geschäftsführer: 5 goldene Regeln und Haftungsvermeidungsstrategien

Die Gesellschaft mit beschränkter Haftung (GmbH) privilegiert ihre Gesellschafter und nicht ihren Geschäftsführer. Dieser hat als Organ fremde Vermögensinteressen wahrzunehmen und dabei die… mehr

Der Anspruch einzelner Gesellschafter auf die Verlegung einer Gesellschafterversammlung

Der Anspruch einzelner Gesellschafter auf die Verlegung einer Gesellschafterversammlung

Es ist nicht immer leicht einen Termin für eine anstehende Gesellschafterversammlung zu finden, der tatsächlich allen Gesellschaftern passt. Unter welchen Umständen ein verhinderter Gesellschafter… mehr

Bausparer können sich nach BGH-Urteil Darlehensgebühren zurückholen

Bausparer können sich nach BGH-Urteil Darlehensgebühren zurückholen

Bausparer können sich nach BGH-Urteil Darlehensgebühren zurückholen mehr